GrainGenes Sequence Report: [Scl616ct910cn1042]
Sequence
[Scl616ct910cn1042]
Probe
[Scl616ct910cn1042]
DNA
gcggggatgcacgagctccagatccccgagggcgtctgcgcgctgccaag
cctcaggaacttcacctactcgtacaactacttctgcaccgagccgcggc
ggtgcctcgacatccgccgcgtcgacgaccggcagaactgcatcgccgga
cggccggatcagcggccgacagaccagtgcctcgacgagcacggctgctt
cgggccgccgacgcactactagagagtggcggcggtgggagagacagaga
gagggagannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnacttgta
aaattggttggtggtgggatgtgaaacagaaaacgaccgtatatattata
tacactgtaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnna
caggagtggtattgattggagtatatgttgggattgtagacagaaatgat
agtgctctgacc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: [Scl616ct910cn1042]
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
