GrainGenes Sequence Report: [Scl610ct903cn1034]
Sequence
[Scl610ct903cn1034]
Probe
[Scl610ct903cn1034]
DNA
agccttcgactgcccggtgagctactaccagcgcacggagcaggcgtcgg
tgtacccaaactacacctactacccgtcggtggtggagctggcgtccaac
agcgacgtgctggtggtggcgtgcccgctgaacgcgtcgacccggcacat
cgtgagccgcgaggtgatggaggcgctgggcccgaagggcgtgctgatca
acatcgggcgcggcccccacgtcgacgagccggagatggtggcggcgctg
gcggacggccggctcggcggcgccgggctggacgtgttcgaggacgagcc
gaacgtgcccgaggcgctgctggcgatggacaacgtcgtgctcgtgccgc
acgtcgggagcggcacctacgagacgcgcaaggccatggcggacctggtg
ctcgggaacctcgaggcccacgtgctcagcaagccgctgctgacgccggt
ggtctgactgcgcgtggtggtggactggtggtggtgttttacacgtacgt
gtgtgtaggagaggggaatggatggtatgtttccgttcgttccgatccag
gggaagaagtcggggtggggaggaagaagcagatgggtgtgttgcggttt
ccttgttttatgatgatgatttacgaataacagcaggtagcgaggcgcag
cagcgcgccagcgcctgatgatgaactctctctctctctctctcagctag
tggcgat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: [Scl610ct903cn1034]
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
