GrainGenes Sequence Report: [Scl597ct889cn1017]
Sequence
[Scl597ct889cn1017]
Probe
[Scl597ct889cn1017]
DNA
gcacggaccaggtcatgtccgaggtgtacctgggccggcagatctgcaac
gtcgtggcatgtgagggcgcggagcgcacggagcgccacgagacgctgag
tcagtggcgcggccgcctcgtcggctccgggttcgagcccgtgcacctgg
gctccaatgcctacaagcaggcgagcacgctgctggcactcttcaacggc
ggcgacgggtacagggtggaggagaaggacgggtgcctgaccctggggtg
gcatacgcgcccgcttatcgccacctcggcgtggcgcctcgccgctccgt
gatcatggggtggggttttggacgctgatcaaggcacacgtcccccggcc
ccgggcatggcgcagcctccccgagctcgccggcgcagttgaagctgtag
acgtgaatgaacgctgaatgaattgcagttattaggcgaccgggccacgg
ttctcgccggcgtgatgagatggactggacactttgactccgaccggatc
ggcctgtgttcgttcttgtttccgatccccctctcttcccgttgcttcaa
tccgtcacctatggtagcccgtagccccctattgttatgtttaaatgtct
attattattattattatgtgtaattcctccaagcgctgatatccaataag
gacgaaccggatttcgttagctcgaatgagaattttgtatacagtgcatc
caatctgaactttagctatgttcatctgttagtcctctgtaatgatgatg
atcgtaatgctgcagcattccgtattgtaattccctcatgat

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: [Scl597ct889cn1017]
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
