GrainGenes Sequence Report: [Scl56ct171cn235]
Sequence
[Scl56ct171cn235]
Probe
[Scl56ct171cn235]
DNA
gcacgaggcccccttcttcctcactcccagacccagatctcttccccaca
gccgccgccgccgccgccgtcggccccaaatctccaaatcccccaaccgg
ccgccatgagggagatcctccacatccagggcggccagtgcggcaaccag
atcggggccaagttctgggaggtggtgtgcgccgagcacggcatcgacgc
caccggccgctatggcggcgactccgacctccagctcgagcgcgtcaacg
tctactacaacgaggcatcctgcggccgcttcgtgccccgcgccgtcctc
atggacctggagcccggcaccatggactccgtccgctcggggccctacgg
ccacatcttccgccccgacaacttcgtcttcggccagtccggagcaggca
acaactgggccaagggccactacaccgagggagccgagctcatcgactcc
gtgctcgacgtcgtgcgaaaggaggccgagaactgcgactgcctgcaagg
cttccaggtgtgccactccctcggcggcggcaccgggtccggcatgggca
cgctcctcatctccaagatccgcgaggagtaccccgaccggatgatgctc
accttctccgtcttcccctcgcccaaggtctccgacaccgtggtggagcc
ctacaacgccacgctgtccgtgcaccagctcgtggagaacgccgacgagt
gcatggtgctcgacaacgaggcgctctacgacatctgcttccgcacgctc
aagctcaccaccccgagcttcggcgacctcaaccacctcatctccgccac
catgagcggcgtcacctgctgcctccgcttcccgggccagctcaactccg
acctccgcaagctggccgtcaacctcatcccgttcccgcgcctgcacttc
ttca

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: [Scl56ct171cn235]
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
