GrainGenes Sequence Report: [Rcl698ct945cn1347]
Sequence
[Rcl698ct945cn1347]
Probe
[Rcl698ct945cn1347]
DNA
atnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcagagttg
catagatatcatcgaaattaatcttcttggttaattaattgtagctagca
ctagcagtagcacatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnt
atacacttcggcnnnnnnnnnnnnnnnnnnnnnnnnccgcaggtatagta
cagtaggatcaaggatgatgtacatgaagaagcttttttttcttttcctt
ttttttgggtagggctctctgtcaaatgtgttggctgttcatggcattct
cttctcttttggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnn

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: [Rcl698ct945cn1347]
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
