GrainGenes Sequence Report: [BG314286.1]
Sequence
[BG314286.1]
Probe
[BG314286.1]
DNA
acgcacgccgccgccgccgccgtcgtcttcgtcttctccactgctaaccc
aacagaggagaaaccaaatagcgcaaattccaatccggtctccaacaagc
aaccccgcggaagctctgccgtcggcgtgtctccttggttcctcgcgccc
gattctccccgatccgaagcaagcaaggtgagtgcgtgccccgcccgcgc
cttgccgcagatcggggagtcccgagagccccaggtgccttttcctcttc
ggtcgtggttgttgttgcgggtgacggagagatggccgggggaggaacag
gaaagggtctggcgcctaggagctgaggatcggcagcggcaacgtgttcg
cggcctcgagacgctcaagaagaagaagaagaagccggcggcggccgaga
agaagcaggcgccttggtggaaaagccagaggtgttctgggcgcccgcgc
cgctcacggccaagtcctgggcgacgttgaggacgatgacgatgatgact
acttcgccaccaccgcgccgctgtgccccgtcgggagtccc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: [BG314286.1]
|
| ||
|
| ||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
