Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: WMC131

[Submit comment/correction]

Sequence	WMC131
Germplasm	Chinese Spring
Species	Triticum aestivum
Data Source	Somers, Daryl J. 2004.06 Isaac, Peter G. 2004.06
Probe	WMC131
Remark	If present, '-----' indicates a break between the forward and reverse sequence.
Reference	Edwards KJ et al. (1996) Microsatellite libraries enriched for several microsatellite sequences in plants. BioTechniques 20:758-760.
DNA	gagcgctctattacttcnnnnnnnnnngcgcaacgtcatgctccgataac cgaannnnnatatatatatatatatatatgagagagagagagagagagan nnnnctaggcgtggaagcagatctagggtagacggtggcggcgggcgcgg tagcgagatggtcgtaggagcggngccggcaaggcgcgacggcgggatga agcgaagaaggactggatgcaaggatcccggcaaggtgcacacggcggga tgaagcgagaggactggatgcaaggatcccggtcccgaagccgtggatga gagaggtcgatctcttgcaatggatggcggcggcgtcggggtatcagctc tggcaggtggaggaggtcggcggaggatgggggcggcggacnngtttttc ccagtcacgacgttgtaaaacacggccagtgacccagtcacgacgttgta aaacacggccagtga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.