Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: PSR137 Reverse

[Submit comment/correction]

Sequence	PSR137 Reverse
Data Source	Devos, Katrien M. 01.05
Probe	PSR137
DNA	cgaattcgagctcggtaccccgctcgctcgatcgtcctccccgccctgca gcagccagccaccatggcctctaccgcgctctccaccgcctccaacccta cccagctctgccggacccgtgcaagctcgctgtgcaagcccgtcaaggct tgggcttcggccgggagcgcatcccgaggaacatcacctgcatggccggc agcactctccgcgg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.