Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: MWG848-5

[Submit comment/correction]

Sequence	MWG848-5
Data Source	Kuenzel, Gottfried 98.05.05
Probe	MWG848
DNA Homology	AA824088 129 noncereal_EST [ Show all 12 ]
DNA	tacggatcttcttcaaccgcgcagggtacacatccacatctctgtcagga catgggggcgctggctgctggatccggggcaccgggggcgggacctcctg gcccttcgatggatggggatgcgggcaaaggccacgacccagccgagcat cgacctgcggggtcatcaacctccggtgatgaggatgatgatgcgacacc atccgtgcagcccaagcccgcagctggcctgggcaagtcttccctggtcc tctcggctggggtgggggcggacgtgctctgcgggtcgcggtggactcac c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.