Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: MWG829-3

[Submit comment/correction]

Sequence	MWG829-3
Data Source	Kuenzel, Gottfried 98.05.05
Probe	MWG829
DNA Homology	RICS13403A 131 rice_EST [ Show all 43 ]
DNA	gctcgctccagtccagtggactctcacgggcctcatttgaacccgggccg ggccgggccgcagacgagcccacgtggagccgctactactcccgcatatc ggcgtcggcggctcctgctcctgctccgacgaccgccgccaccagcagta gcagagggtcgtcgtcgtcaccgccggagacatgtcgaag

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.