Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: ABC152-5

[Submit comment/correction]

Sequence	ABC152-5
Data Source	Kuenzel, Gottfried 98.05.05
Probe	ABC152
DNA Homology	RICC0425A 664 rice_EST [ Show all 422 ]
DNA	ctccaccggcggcaaggccccccgcaagcagctcgccaccaaggcggcga ggaagtcggcgccgaccaccggcggcgtgaagaagcctcaccgctacagg cccgggaccgtggcgctccgcgagatccgcaagtaccagaagagcaccga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.