GrainGenes Sequence Report: AB334127
Sequence
AB334127
Subsequence
AB334127_1.cds 409 861
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC278304
NCBI UniGene
Ta.54615
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'BZIP transcription factor'
Species
Triticum aestivum
Cultivar
Chinese Spring
Tissue
leaves
Developmental Stage
seedling
Data Source
genbank Downloaded 2008-2009
Title
Triticum aestivum Wlip19a mRNA for basic region/leucine zipper protein, complete cds.
Gene
Wlip19a
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA';
EMBL Feature
feature_gene 1 885 Location: 1..885
DNA
tccctgtagtttggttttccttaagagtctactccctgttccgttgcaaa
taagcccctgagctctgtcctattctagcctcaactccttggtctcggga
ggagttcgtcgcagattcgatctagagagcctccccgcaccacccatgtt
taccctccccttcctctgacggccgccgtcccccgatgaagctgcgcgtc
cgctgccgctcccactccttctccgtcgccttcctctactggttctacga
cttctcatgaactcctcgccccccgacaacgccgcatccatccagcctct
agttgattagatccagcctcgtttcttccactttcttgccttcttcctcc
ccaccatcaaagaaaagagatctcttttctggttcttggatcaagaaccc
gaccgaccatgtcgtcgccgtcgcgccggagctccagccccgagagcaac
atcgacggcggcagcggcagcggctccgccggtgacgagcgcaagcgcaa
gaggatgctgtccaacagggagtcggcgaggcggtcccgcgctcgcaagc
agcagcggatggaggagctcatcgccgaggccagccgcctccaggccgag
aacaagcgcgtggaggcccagatcggcgcctacacgaccgagctgaccaa
ggtggacggcgagaacgccgtgctccgcgcgcgccacggcgagctcgccg
gccggctgcaggcgctcggcggcgtcctggagatcttccaggtggccggc
gcgcccgtggacatcccggagatccctgacccgctgctccgcccatggca
gtccccgttcgcgccccagctggccaccgccggcggcatgcctgacgcgt
tccagttctgagccaagacaagtcatgccacggcg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: AB334127
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
