GrainGenes Sequence Report: Ta.24529.1.S1_x_at
Sequence
AY131234
Contig
Ta.24529.1.A1_at Ta.24529.1.S1_at Ta.24529.1.S1_x_at
Subsequence
AY131234_1.cds 1 207
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC348771
NCBI UniGene
Ta.56003
Data at Gramene
Gramene-Protein Q8H1Z1
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Hypothetical LOC543081'
Species
Triticum aestivum
Data Source
genbank Release 135, Apr 15 2003
Title
Triticum aestivum putative low temperature and salt responsive protein mRNA, partial cds.
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA';
DNA
tgccggtgcctggagatcctgtgcgccatcctcctcccgcccctcggcgt
ctgcctccgccacggctgctgctccatggagttctggatcagcgtgctgc
tcaccatcctcggctacctccccggcgtcctctacgccgcctacgtcatc
tgctccgtcgaccccgaccgcgtccgccgccgcgacgacgactacatcta
cgtcgcc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ta.24529.1.S1_x_at
|
| ||||
|
| ||||
|
| ||||
|
| ||||
|
| ||||
|
| ||||
|
| ||||
|
| ||||
|
| ||||
|
| ||||
|
| ||||
|
| ||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
