GrainGenes Sequence Report: Ta.2795.1.S1_a_at
Sequence
AW448831
Contig
Ta.2795.1.S1_a_at
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC303139
NCBI UniGene
Ta.2795
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Granule-bound starch synthase'
Keyword
EST
Species
Triticum aestivum
Cultivar
Wyuna
Clone Library
BRY
Data Source
genbank Release 135, Apr 15 2003 genbank Updated Nov 2006
Title
BRY_1580 BRY Triticum aestivum cDNA clone P56-1P, mRNA sequence.
Clone
P56-1P
Probe
[Wcl149ct671cn1036]
Remark
DB_xref: taxon:4565 Feature: source: cell_type = 'endosperm' Feature: source: mol_type = 'mRNA'; cell_type = 'endosperm'; Locus Comment: Contact: Bryan Clarke; Division of Plant Industry; C.S.I.R.O.; GPO Box 1600, Canberra, ACT, Australia; Tel: 61 2 6246 5054; Fax: 61 2 6246 5000; Email: bryanc@pi.csiro.au.
DNA
ccggagccacgcaccgttcgtttccttgagtcccgtcactttcgcccgcc
cgccccacacactacaaccaggagcctcgatctgccagtgaagaagaaga
aggacactcacgaatgcccggccggcgactgtgagtacgctcccgtccag
gaagaagaagaagaagaagaagcagaagaagaagaagcagaagaagagat
cagaccagtcgtctcttgctgcaggtagccacaccctgcgcgcgccatgg
cggctctggtcacgtcccagctcgccacctccggcaccgtcctcagcgtc
accgacagattccggcgtccaggttttcagggcctgaggccccggaaccc
ggcggatgcggcgctcggcatgaggactgtcggagcgagcgccgccccaa
agcaaagcaggaaaccgcaccgattcgaccggcggtgcctctccatggtg
gtgcgcgccacgggcagcggcggcatgaacctcgtgttcgtcggcgccga
gatggcgccctggagcaagactggcgg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ta.2795.1.S1_a_at
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
