GrainGenes Sequence Report: DQ863129
Sequence
DQ863129
Subsequence
DQ863129_1.cds 1 431
External Databases
Data at GenBank Data at EMBL Data at DDBJ
NCBI UniGene
Hv.29819
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare (domesticated barley) UniGene title 'WRKY transcription factor 44 (WRKY44)'
Species
Hordeum vulgare subsp. vulgare
Cultivar
Optic
Data Source
genbank Downloaded 2008-2009
Title
Hordeum vulgare subsp. vulgare WRKY transcription factor 44 (WRKY44) mRNA, partial cds.
Strain
vulgare
Gene
WRKY44
Remark
DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA';
EMBL Feature
feature_gene 1 431 Location: <1..>431
DNA
caacaagacgagccggtgccgcctccggtgctgcaagccgcgggcgtgca
aggccccgtcggcgaagggtcgagatccaagagaaagaagaaggtggtga
agaaggtggtgaagcgggtggcggcggacggcacgtcggcggacccgtgg
gcgtggcgcaagtacgggcagaagcccatcaaggggtcgccgtacccgcg
cgggtactaccggtgcagcaccgacaaggcgtgcgaggcgcgcaagatgg
tggagcgctgccgcgacgaccccaactccttcatcctcacctacaccggc
ggcgagcacagccaccccgcccccgcccaccgcaactccctggccggcac
cacgcgcaacaggcaggcgccggacccagctcccagacaccagggcgctc
ccgccgccaaagccaccggggagtcgtcgtc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: DQ863129
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
