GrainGenes Sequence Report: DQ863123
Sequence
DQ863123
Subsequence
DQ863123_1.cds 1 543
External Databases
Data at GenBank Data at EMBL Data at DDBJ
NCBI UniGene
Hv.29818
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare (domesticated barley) UniGene title 'WRKY transcription factor 40 (WRKY40)'
Species
Hordeum vulgare subsp. vulgare
Cultivar
Barke
Data Source
genbank Downloaded 2008-2009
Title
Hordeum vulgare subsp. vulgare WRKY transcription factor 40 (WRKY40) mRNA, partial cds.
Strain
vulgare
Gene
WRKY40
Remark
DB_xref: taxon:112509 Feature: source: mol_type = 'mRNA';
EMBL Feature
feature_gene 1 543 Location: <1..>543
DNA
ggcacgagggagtttccgcggagctactacaagtgcactcacccaacctg
ccctgtcaagaggaaagtggagacaacagtagatggccaaattgcggaaa
ttgtgtacaacggtgaacacaaccatccgcagccccatcctccaaaaaag
ccaacgtcatcggcaagtacagaagttttggtccctggcgcccatggcag
caatgatgctggagcagaaagccaggtaggagggtgcaacctcgttcttg
gttcagctcctgttgccacggcattcagaagcagctgtgattgcgttgat
gaatttggtaatactagtccggtctatcactgcaacacaagccggaagga
gaagcaatcaagtatcacaaatggcctgacttcttctagtgaggctgctc
ctgcattccagtctccaaccgaatgcgagtcatctagggatgcggcattc
cgttggcgcaagtatggtcagaaggctgttaatggtaattcatttccaag
gagctactacagatgcagcacagcaagatgcaacgctcgcaag

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: DQ863123
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
