Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CK208264

[Submit comment/correction]

Sequence	CK208264
Contig	TaAffx.14828.1.S1_at
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC309750
NCBI UniGene	Ta.35580
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, weakly similar to NP_193364.2 LDL3 (LSD1-LIKE3); amine oxidase [Arabidopsis thaliana]'
Keyword	EST
Species	Triticum aestivum
Clone Library	Triticum aestivum FGAS: Library 5 GATE 7
Data Source	genbank Release 139, Dec 15 2003 genbank Updated Nov 2006
Title	FGAS019963 Triticum aestivum FGAS: Library 5 GATE 7 Triticum aestivum cDNA, mRNA sequence.
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Wm L Crosby; Bioinformatics; University of Saskatchewan, Department of Computer Science; 1C101 Engineering Building, 57 Campus Drive, Saskatoon,; Saskatchewan, S7N 5A9, Canada; Tel: 306 966 1769; Fax: 306 966 2033; Email: fgas_ests@cs.usask.ca; This sequence is the direct result of the Base calling software; Phred (default parameters). It is the raw base calls. To aid in the; identification of the high quality insert the software Lucy; (default parameters) has been run on this sequence. Lucy identified; the region [16,743].; Plate: L5B013 row: J column: 06. Note: Vector: pCMV.SPORT6; Crown and developmental stages of spike formation in wheat cultivar Norstar. 4 mRNA populations were combined before constructing the library. The first mRNA population is from 1cm crown sections after 30 days of cold acclimation. The second is from 1cm crown sections after 11 days of deacclimation (before deacclimation plants were fully vernalized for 49 days). The third is from different developmental stages of spike formation (5 to 50mm) that still have not emerged from the leaf (dissection required). The last is from different developmental stages of spike and seed formation after having emerged from the leaf (visible). First strand synthesis in this library was done in the presence of methylated dCTP thereby protecting from internal cleavage with NotI.
DNA	cagagcggccgcccttttttttttttttttttttttttttttttttttcc tttgggaactcttctggcacttagcagtcgtaaatggtgaccagtataag cagctgggggatatacagagggctgcagcaacctgcagatgccaaccatc tccgccaaaccgcaacgacttttaacacgaccgactatgagttaggtgat tgctaggaacaggatacggagctatggtctgtacaacaaacggaaaaaag atggggtctagtctggtgtcagttttctctgaacaaggcaacaacatggg ttctgctacgctgacctaaaactactgtccagggatacattcgagccacc cttgcatgttgagaccatgcggaatgcttgaattcatcccagatcttcat atgccacttcggtacaagccatagagttcaactcatcacacaagttcact gcatgcgcagccatgtttgtctgagtgcacagaggtctaggaagccattg caacgatgatgatgatgatggaggtgatatcaacttcaatacaaggatga atgtgtcaatctggttcatggttcggttttgcccccaaggcttgtgaaac catgtctgcttcttttaggtcccatggagccaatgcctgatgagcgacag catagtctgcaaggtgaaatttgcttctccacatgtaacagcttcctaga tatgtacatgctatgatttgggggctggagccacatgccaatgcctctcg accaacttatccacaaatgtttgaatcttagttttccttctaaaatcgag aaattcattgggagtcatcagcttctctccctcaggcatgcatcaattat ctttgggacggcttcccgaatcatggcttgtatgcctcccggtcgatttt ttactttggtcaggggctccatagggggccattaaagctatcaccccttt tttatttttctaacccgcgggttgtcctcgattcgggttggtttcggacc cggagggaaaattttggttttggttttgggcccccaacccccccctgggg ttgggttcccagggaaaatcttttattgtcccagggtgggtggccccccc caaggggtaggaagtgg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.