Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CK197322

[Submit comment/correction]

Sequence	CK197322
Contig	Ta.23676.2.S1_at Ta.23676.2.S1_s_at
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC296375
NCBI UniGene	Ta.46369
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus'
Keyword	EST
Species	Triticum aestivum
Clone Library	Triticum aestivum FGAS: Library 3 Gate 6
Data Source	genbank Release 139, Dec 15 2003 genbank Updated Nov 2006
Title	FGAS005793 Triticum aestivum FGAS: Library 3 Gate 6 Triticum aestivum cDNA, mRNA sequence.
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Wm L Crosby; Bioinformatics; University of Saskatchewan, Department of Computer Science; 1C101 Engineering Building, 57 Campus Drive, Saskatoon,; Saskatchewan, S7N 5A9, Canada; Tel: 306 966 1769; Fax: 306 966 2033; Email: fgas_ests@cs.usask.ca; This sequence is the direct result of the Base calling software; Phred (default parameters). It is the raw base calls. To aid in the; identification of the high quality insert the software Lucy; (default parameters) has been run on this sequence. Lucy identified; the region [102,776].; Plate: L3C107 row: K column: 06. Note: Organ: Root; Vector: pCMV.SPORT6; Root tissue from control, cold-acclimated and salt stressed wheat cultivar Norstar. 7 mRNA populations were combined before constructing the library; 7 day non-acclimated roots, 1, 23, and 53 days cold-acclimated at 4C, and 30 minutes, 3 hours and 6 hours treated roots with 200mM NaCl. Non-acclimated and cold-acclimated plants were grown in vermiculite while salt stressed plant were grown hydroponically. First strand synthesis in this library was done in the presence of methylated dCTP thereby protecting from internal cleavage with NotI.
DNA	caccagctattcgatataggcctatctaggtnactagattgaacangttt gtacaaaaaagcaggctggtaccggtccggaattcccgggatatcgtcga cccacgcgtccgcatgaacgactggcggcggcgactggaagacctcctcc gtccaccgctcaagtctcctccgtccaccgctcctgcctcctccgtccgg cgactgcgacacccctgccctcctcccttcgacgctctgcccctccagat ggggcgacgggaccggggtcgccatcctactacttcccagatctcgtctc cacccccaagatcttcaccttccgatgatgacgacggccaggagatcatg ctcctcttcgtccaagatccaagagcctcctctcctgtttgagttttgta tcacaagaaccaataccgaagaacatccatcgtttgcagtagtgtttcta cctgactatcctgacctcacaacaaagccaattgatagtattatcgatgc agtgctattaagtcatcaattactaatgtactgttagaaaacggccttta ctgattgaaggagaaaattgctaccaaggagaaaacataaggtatgtaat tttgaagtactcccttcgttccgaattacttctcgcagatatggatgtat ctagatgtattttagttctagatacatccatttttatgacaagtaatttg gaacggagggagtaccaatttagaggtgcagttttgtgttttcttccatt gggcattttcaatttgttcatgaatttgcacatgttaactcataa

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.