GrainGenes Sequence Report: CD862882
Sequence
CD862882
Contig
Ta.3273.1.S1_at
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC280626
NCBI UniGene
Ta.13508
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001044320.1 Os01g0761000 [Oryza sativa (japonica cultivar-group)]'
Keyword
EST
Species
Triticum aestivum
Cultivar
recital
Clone Library
AZO1
Tissue
leaf
Data Source
genbank Release 137, Aug 15 2003 genbank Updated Nov 2006
Title
AZO1.104P10F010129 AZO1 Triticum aestivum cDNA clone AZO1104P10, mRNA sequence.
Clone
AZO1104P10
Probe
CFE71
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Genoplante; Genoplante; 93, rue Henri Rochefort 91025 EVRY CEDEX France; Tel: 33 1 69 47 54 00; Fax: 33 1 69 47 54 10; This sequence has been generated in the framework of the french; plant genomics programme 'Genoplante' (http:
DNA
agtggactagggagctcgctctcacatccgctgctgcctgcctgctgcag
acgacggccaaacagtagtttccccggttgctccacgcaccatcctccgg
acgcgcctcccagctccttcgtagctacctatcctgcgacaatacccagg
cgggggatcctagccatgatggcatgtgccctctccatcgcccagcctac
cgccctcgcgccgtgcggcggcggcggcggcggcagcagcaagagcatcc
ccaggaatctcccgaagctgcgaagccccatggtttcaggcaggatgaga
agtcgcggtgtcgttgccagggctgcgcaggacagttcagaagcctcctc
cgggagcgtcgtcaaatacgtcaagagttcgttcaacactactgaagaca
tatttgctctagcgggtatcggctttgcagccattgcggcattctgggct
tccatgatgcttattggggtcatcgacaagctccctgttctccctctttt
cttcgaactaatcggaatagcagttgcatggtggtttatctacgggaacc
tcctcttcaagccagacagggaaaagtttctggagaacatcaaaagctca
gtatctcgaatcttggggcagtaacttcgccgcgaagacaaagtacatcc
tgcctacgacatacattntctttgggcctgtcagaaacattta

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: CD862882
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
