Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CD491338

[Submit comment/correction]

Sequence	CD491338
Contig	Ta.26604.1.A1_at
External Databases	Data at GenBank Data at EMBL Data at DDBJ
NCBI UniGene	Ta.49740
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001045607.1 Os02g0103700 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Clone Library	CS wheat cold-stressed seedling subtracted cDNA library
Tissue	Seedling
Developmental Stage	Five-day old seedling
Data Source	genbank Release 136, Jun 15 2003 genbank Updated Nov 2006
Title	WHE3084_F11_K22ZT CS wheat cold-stressed seedling subtracted cDNA library Triticum aestivum cDNA clone WHE3084_F11_K22, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE3084_F11_K22
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized , germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Five-day old seedlings were transferred to 5 C cold room and kept for 48 hr. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. The cDNA clones were in vivo excised to give pBluescript phagemids before subtraction was carried out. The mass excision of phagemid library and subtraction were done in HT Nguyen lab by D. Zhang at Texas Tech Univeristy. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Five-day old seedlings were transferred to 5 C cold room and kept for 48 hr. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. The cDNA clones were in vivo excised to give pBluescript phagemids before subtraction was carried out. The mass excision of phagemid library and subtraction were done in HT Nguyen lab by D. Zhang at Texas Tech Univeristy. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	ttttttttttttttttttcaaattaataaactaccatcttcgtttcaacc acaacactggcagtcaactatctttagggaatgagaaacaaggttcatat tcttaaacagggacgacaatatgtaggataagataacatgctccataaca catcctaaccaagaacaaaattcagtctccgaaaattgcaacccaaacga taatggcaacatgccaggcagatgtagcacttctggatcatctccaggca ttttagctacgttgtcgctcactgctcctcctcgatcacacccttgtcgc tgacatagataccgtccaagaactttctgatatccttcttcttgacatgg catttctggttgatgagggcggcggagcgagagacgagctcgatgtcgtt gccgtcgaggatgagctcatccttaaccttctcggaccgcaggatggtca cgccatcaagcatgtccaccttcctgaccttcttctcgccgaggaagttc ctgatctcgatggcggtgttgctgttggtgatggaggcgttgatggggaa gtgagcgtataccaacctcatcttgtagcggtacccc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.