GrainGenes Sequence Report: CD454480
Sequence
CD454480
Contig
Ta.9338.1.S1_at NSFT03P2_Contig8765
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC307733
wEST map position
CD454480
NCBI UniGene
Ta.18783
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001130156.1 hypothetical protein LOC100191250 [Zea mays]'
Keyword
EST
Species
Triticum aestivum
Cultivar
Chinese Spring
Chromosome
2DS
Clone Library
CS wheat pre-anthesis spike cDNA library
Tissue
Spike before anthesis
Developmental Stage
Adult plant
Data Source
genbank Release 136, Jun 15 2003 genbank Updated Nov 2006
Title
WHE2320_B06_D12ZT CS wheat pre-anthesis spike cDNA library Triticum aestivum cDNA clone WHE2320_B06_D12, mRNA sequence.
Strain
lab_host E. coli SOLR
Clone
WHE2320_B06_D12
Probe
WHE2320_B06_D12
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Whole spike with awns trimmed, white, green and yellow anther were collected and total RNA, and poly(A ) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors). Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Whole spike with awns trimmed, white, green and yellow anther were collected and total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
tttttttttttttttttttttttttttttttttttgcgtataagtcctta
tttcccatgaatttgggtatctgttcaaacaacaaatcagataaacataa
ccaatcgtgcccatcatacaccggaacaacagacggcaagtcctatcctt
agatgtcgcttagtatctattctcagttcattgtcagccagaaccaaggt
ttgacaaaagaatcaaagacatccacatgctcgacagcctcagttcttgc
tagcttcttcagcctgcttctcgtctgcgacatcgctgggcatatcaagc
ccggtcggtatcttcccagcgaagttgtatttagaggcatccgatccaag
gttacttctgtc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: CD454480
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
| ||||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
