GrainGenes Sequence Report: Ta.1544.1.S1_at
Sequence
CD453950
Contig
Ta.1544.1.S1_at NSFT03P2_Contig18536
External Databases
Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index
TC351756
wEST map position
CD453950
NCBI UniGene
Ta.1544
DB Remark
Locus Source: Triticum aestivum (bread wheat) UniGene title 'Beta-tubulin 2'
Keyword
EST
Species
Triticum aestivum
Cultivar
Chinese Spring
Chromosome
3AS 3BL
Clone Library
CS wheat 5-15 DAP spike cDNA library
Tissue
Spike
Developmental Stage
Adult plant
Data Source
genbank Release 136, Jun 15 2003 genbank Updated Nov 2006
Title
WHE0926_B01_C02ZT CS wheat 5-15 DAP spike cDNA library Triticum aestivum cDNA clone WHE0926_B01_C02, mRNA sequence.
Strain
lab_host E. coli SOLR
Clone
WHE0926_B01_C02
Probe
WHE0926_B01_C02
Remark
DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants were grown in the greenhouse. Spikes at 5, 10 and 15 DAP were harvested, total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA
tttttttttttttttttttagctgacgggctgaggccacttgagaatttc
aatactactccgtatgttggaaccattataccctgcatacagtctgacga
aataatttgcaagaaataccaactcagaagccattcaccaccagagaggt
ccagaaacctcaacacagaacataccggatggcatcaagtgatacaatac
cgaaaaggtgccataacatgagaaatacaaagcttaggaaaggcatgaag
aatggcggtggcgtacaagcggtagttgcgatgataaacagatttataac
aaagcaccaaacagatcaaactctgcccccagaacccccccacccagcaa
agcaccacatggacctcccaccttacatgtcctcctcaggctcctgatct
tcatcctcgtactcgccctcctcatcggcagtagcatcctggtactgctg
gtactccgagacaaggtcgttcatgttgctctcagcctcagtgaactcca
tctcgtccatgccttcaccagtgtaccaatgcaagaaagccttcctcctg
aacatggcagtgaactgctcgctcaccctccggaacatctcctggatgga
ggtcgagttgccaacgaaggtggacgccatggagagccctgtcggtggga
tgtcacagacgctggacttgacattgttggggatccactccacaaagtag
gatgagttcttgttctggacgttgatcatctgctcgtcgacctcctttgt
gctcatctttcc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.
GrainGenes Sequence Report: Ta.1544.1.S1_at
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
| |||||
|
|
GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture. | |||
