Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CD453605

[Submit comment/correction]

Sequence	CD453605
Contig	Ta.25297.1.A1_at NSFT03P2_Contig10051
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC290662
wEST map position	CD453605
NCBI UniGene	Ta.24529
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, strongly similar to NP_001045614.1 Os02g0104700 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	6AS 6DS
Clone Library	CS wheat vernalized crown cDNA library
Tissue	Crown tissue of seedling
Developmental Stage	Five-week old seedling
Data Source	genbank Release 136, Jun 15 2003 genbank Updated Nov 2006
Title	WHE0817-0821_B23_B23ZT CS wheat vernalized crown cDNA library Triticum aestivum cDNA clone WHE0817-0821_B23_B23, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE0817-0821_B23_B23
Probe	WHE0817-0821_B23_B23
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were germinated and grown at 4 C for 5 weeks. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	tttttttttttttttttatatatgcaacaagtgtaaccacagcaacattt cactccgaggtttccntgaatcattttcatcagctgatcctaagctagaa ctatgaattcatccctataagatcatccaagaaacataatgtcggtgcgc aactggatcacgcggagctgctccagcagcaacagcagcatacacagaga ccaaaaataggcatttggcaaccgcagcatcagtaatgccacttgggtct cagctcctcttctacctcggtcagctcctggtatcggtaccactgcgatg ccgctttaccgacgggcagtggggcgcggacaaagacctcgactggtttg ggtacatgtactcttaaatgcaactcgccactgccgccgccttcttcctc gacgcagctatcagggtcgctagatggcacaccaagtggttcgaccgcga tccacccgagtccagatatcgcaatgtcactagcaggcctatcaagctct tcatactttatctgcaattcgcgaacgccctgaagcccacaccatccttc agctctctcctggccggttgggggagtcaatgtaactccgacttctctct tgtaaaattcatctgcttctgtggtggggaccatattaatacttagcttc tttggtccatagaatgttagccgtgtgcgtggaagagctta

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.