Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CD453558

[Submit comment/correction]

Sequence	CD453558
Contig	Ta.4449.1.A1_at NSFT03P2_Contig5615
External Databases	Data at GenBank Data at EMBL Data at DDBJ
NCBI UniGene	Ta.31737
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_568655.2 APE2 (ACCLIMATION OF PHOTOSYNTHESIS TO ENVIRONMENT); triose-phosphate transmembrane transporter [Arabidopsis thaliana]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Clone Library	CS wheat vernalized crown cDNA library
Tissue	Crown tissue of seedling
Developmental Stage	Five-week old seedling
Data Source	genbank Release 136, Jun 15 2003 genbank Updated Nov 2006
Title	WHE0806_C04_E08ZT CS wheat vernalized crown cDNA library Triticum aestivum cDNA clone WHE0806_C04_E08, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE0806_C04_E08
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Seeds were germinated and grown at 4 C for 5 weeks. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	tttttttttttttttttttttttgggcctttaatagttctccagccgtat attaagctgagctgcaagaagtctggcttaaactaccctaagatattaaa aaaattgatctatgcattatctatcatggcagtacaaagaacactaaaaa taataaaaattacatctagtttcatagacaacctagcgccgactaaagca ctggagtgagccgaaagcacacctctgtcatcgcctctccctcaacgggc cgggcaaaacttgttgtactaaatatagtcgggaagtcatcatgctatgc taagaccccacacgaccaaggcaccagaacatcaaccatcgacgatgaag agaaccacagatcggaaggtacaacttgtacacacacggacaaacactgg atcaacggagattcagcaaagaccaataccgactgaatcccaagcagtcc gccgaagacacacatccacatgccctccaacaacgcaagacgcactgtca ggacgggggctaggcggagaggaccttattccatcttcaaggagccgccg ccgccacaccttcctttttctcctcaatcttagccttgataactgagtat agggcaacaccagaaatagcaatggctgtgccaattccagtttgtgtggt gatcttgttgccgaaaatgatgattg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.