Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CD453417

[Submit comment/correction]

Sequence	CD453417
Contig	Ta.25209.1.S1_at NSFT03P2_Contig8291
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC299954
NCBI UniGene	Ta.38679
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_680210.2 EMB1030 (EMBRYO DEFECTIVE 1030); ATP binding / alanine-tRNA ligase/ ligase, forming aminoacyl-tRNA and related compounds / nucleic acid binding [Arabidopsis thaliana]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Clone Library	CS wheat heat stressed flag leaf cDNA library
Tissue	Flag leaf
Developmental Stage	Full tillering stage
Data Source	genbank Release 136, Jun 15 2003 genbank Updated Nov 2006
Title	WHE1659-1662_K21_K21ZT CS wheat heat stressed flag leaf cDNA library Triticum aestivum cDNA clone WHE1659-1662_K21_K21, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE1659-1662_K21_K21
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants at full-tillering stage were heat stressed under four conditions: (1) 38 C for 2 hours, (2) 38 C for 4 hours, (3) 2 days of cyclic treatment of 38 C for 2 hours, (4) 2 days of cyclic treatment of 38 C for 4 hours, at Texas Tech University (D Zhang in Nguyen lab). Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton, Malatrasi) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	tttttttttttttttttacacttggaagaatcaaggaaagtccaaaaaat gtctgcttgcactcttggtggccagaaggaacgatttacataaacccaga aaggggcaacaatttacatatgcttgtgaatatatgctctatttcctatg tatgtaaatggctctatcgaagatcagctggcttttgaagataccgctgc aacaatttcagctctagccttctctagggcatccggtaagttctctggct tccgaccgccagcctgcgcaaagttcggtttgccaccaccacctccaccg caaagtttcgctattccacccacaaacttgcctgcttgcactcccaattt cacgactccaggactgaaggcagcgaccaggctcaccttaccgtctcctg gacttgaacctaaaatcaccgcggctgggtcttggagggttcccacgaga tgctcagctgcgcttttcagcccatcagcatccacatcccccatgttctc aactaggatcctgacattatgaggttcaacgagtacagctttacttgcca gggatgctgctttaagcactgcgattttgctgcgtagagatgatgcttca tttctcgctgttcttagttcttcaagaattgtttctactctgctgttgac atcttctgctttgaccttaagcgaagagcataagtgtcgcatgtagttgt cccgtgaacaacatactcaacaaatgcatcacctgcaactgcctcaatcc ttctgact

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.