Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CD453384

[Submit comment/correction]

Sequence	CD453384
Contig	Ta.25832.1.A1_at
External Databases	Data at GenBank Data at EMBL Data at DDBJ
wEST map position	CD453384
NCBI UniGene	Ta.25832
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, weakly similar to NP_001066542.1 Os12g0268000 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	2BS
Clone Library	CS wheat heat stressed flag leaf cDNA library
Tissue	Flag leaf
Developmental Stage	Full tillering stage
Data Source	genbank Release 136, Jun 15 2003 genbank Updated Nov 2006
Title	WHE1655-1658_B07_B07ZT CS wheat heat stressed flag leaf cDNA library Triticum aestivum cDNA clone WHE1655-1658_B07_B07, mRNA sequence.
Strain	lab_host E. coli SOLR
Clone	WHE1655-1658_B07_B07
Probe	WHE1655-1658_B07_B07
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid; Site_1: EcoRI; Site_2: XhoI; Plants at full-tillering stage were heat stressed under four conditions: (1) 38 C for 2 hours, (2) 38 C for 4 hours, (3) 2 days of cyclic treatment of 38 C for 2 hours, (4) 2 days of cyclic treatment of 38 C for 4 hours, at Texas Tech University (D Zhang in Nguyen lab). Total RNA and poly(A) RNA were prepared, a cDNA library was made, and the cDNA clones were in vivo excised to give pBluescript phagemids in the TJ Close lab (Choi, Close, Fenton, Malatrasi) at the University of California, Riverside. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	ttttttttttttttttttttttttttaaaacttgctcagattgtacttcc aaatattttcatagagatactattttatatagataatatcacccaaaata atatgaaaaatagtctgatagtccaacttttacagtgagagatattctgg ttcggtaaaggtgctagatattcatattactatatcattgccacgtctat atggaaatagctttggagcgtggatatggaatagctatcagctgcaggtc aaactttctgcttaaggtgataccaaaattctcaggagatgtccaccgac tctgcagtaggcccgttgggaatcacccagccgaagtggtagagaagatt tgccaagaccatctccacggttgacgtgccgaacaacatccctgggcatt gccttcgcccagccccgaaaggggtgaattcaaaatgtgtcccataataa tccaccttgttgttctgaaacctctctggcttgaactcttcaggattgtc ccaatatttaggatcccgggaaattgcaaaaacattaacaaagatattag ttcctttaggcatgtcatagcccatgattttacagtcctctcttgtctct cttgggatgaggaggggaacaggaggatgcaacctaaacacctccttgat gaccatcctcatgtagcgcagctcactaaggtcggtactcttgatgacat gt

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.