Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: CD452464

[Submit comment/correction]

Sequence	CD452464
Contig	Ta.26071.1.A1_at
External Databases	Data at GenBank Data at EMBL Data at DDBJ
TIGR Gene Index	TC298362
wEST map position	CD452464
NCBI UniGene	Ta.40126
DB Remark	Locus Source: Triticum aestivum (bread wheat) UniGene title 'Transcribed locus, moderately similar to NP_001046754.1 Os02g0448000 [Oryza sativa (japonica cultivar-group)]'
Keyword	EST
Species	Triticum aestivum
Cultivar	Chinese Spring
Chromosome	6AS 6BS 6DS
Clone Library	CS wheat etiolated seedling root normalized cDNA library
Tissue	Root
Developmental Stage	Five day old etiolated seedling
Data Source	genbank Release 136, Jun 15 2003 genbank Updated Nov 2006
Title	WHE1105_B09_C17ZT CS wheat etiolated seedling root normalized cDNA library Triticum aestivum cDNA clone WHE1105_B09_C17, mRNA sequence.
Strain	lab_host E. coli DH10B
Clone	WHE1105_B09_C17
Probe	WHE1105_B09_C17
Remark	DB_xref: taxon:4565 Feature: source: mol_type = 'mRNA'; Locus Comment: Contact: Olin Anderson; US Department of Agriculture, Agriculture Research Service, Pacific; West Area, Western Regional Research Center; 800 Buchanan Street, Albany, CA 94710, USA; Tel: 5105595773; Fax: 5105595818; Email: oandersn@pw.usda.gov; This EST was generated by sequencing from the 3' end of the clone.; Sequences have been trimmed to remove vector sequence and low; quality sequence with phred score less than 20.; Seq primer: T7 primer. Note: Vector: Lambda Uni-ZAP XR, excised phagemid pBluescript SK; Site_1: EcoRI; Site_2: XhoI; Seeds were surface-sterilized, germinated and grown aseptically in the dark at room temperature on filter paper with water, nystatin and cefotaxime in covered crystallization dishes. Roots were harvested. The tissue, total RNA, and poly(A) RNA were prepared, a cDNA library was made in the TJ Close lab (Choi, Close, Fenton) at the University of California, Riverside. The cDNA clones were in vivo excised to give pBluescript phagemids before normalization was carried out. The mass excision of phagemid library and normalization were done in HT Nguyen lab by D. Zhang at Texas Tech Univeristy. Normalization protocol used was that of Soares'. Plasmid DNA preparations and DNA sequencing were performed in the OD Anderson lab (all other authors).
DNA	ttttttttttttttttttttaaccgaaacataactgatgtagacaacgat acatatcagaaaaatcctgatgcggacatgctatttaacaagatccgaaa tggtatgcaataattcccacggaaatccttcgagatgcgacgttaaggaa gaaagctaattaaaacacataacctttctaacgtgccggctgcagggtcc agcggccgtgattagaacggtgacgggcggccaccggctgtgcctgggtt ccatctgcagccggcggcttccggcgggagctgcacgttgccgaggaggt tcggtggcagcccttcgaagaggcttggatccacgtctccgccggccatc tgagatgcttgctgccccgcagccagcatcccggtgctgtctgcctgccc ttgcgctgcaagcaactcgtcttcctccaacggcaatcgctcgtagacag cgttcgcgaaggaagctgccattatcaccaccggccccgcggcggtcagc gagccgacaacggtgccgccgaccacctgccccttcccgccggcaaggta gacggtgagccccgtggcttccggtggtgctggagggggtaggaaggagc cagacagtgagagtatctcgaaccggccgtggagggcgacaaccgcgccc tgcgaggcaggctgccgcagcgtgacgttggtc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.