Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: Xstars-KASP728

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	Xstars-KASP728
Reference	Xu X et al. (2025) Characterization of a new Lr52 allele for leaf rust resistance in the Iranian wheat landrace PI 622111 Plant Genome 18.
General Remarks	SNP location (bp) on 5B in IWGSC RefSeq v2.1 = 9, 014, 878 Allele (PI 622111 allele/Yuanyu 3 allele) = A/G
Type	KASP
PCR primers	Forward Allele-specific 5' GCACTTGTTGTTGCTGCAGT Forward Allele-specific 5' GCACTTGTTGTTGCTGCAGC Reverse 5' CGTGAGTGCTTTTGGTAGTCG
Source Species	Triticum aestivum