Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: Xusw59

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	Xusw59
Reference	Maccaferri M et al. (2019) Durum wheat genome highlights past domestication signatures and future improvement targets Nature Genetics 51:885-895. Wiebe K and Pozniak C MAS Wheat. Bringing Genomics to the Wheat Fields. Reduced cadmium concentration MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks	See the MASWheat webpage for amplification conditions and note that those conditions should be considered only as a starting point of the method optimization at individual laboratories.
PCR primers	usw59-F 5'- TTCTTGCTGTTCATCCGCCTG -3' usw59-R 5'- AATACGGGACTGCGAGACGGC -3'