Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: PLATZ-A1_Promoter

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	PLATZ-A1_Promoter
Reference	Zhang J et al. (2023) Wheat plant height locus RHT25 encodes a PLATZ transcription factor that interacts with DELLA (RHT1) Proceedings of the National Academy of Sciences, USA 120. Dubcovsky J MAS Wheat. Bringing Genomics to the Wheat Fields. Plant height gene Rht25. MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks	'384-bp insertion in the promoter region 130 bp upstream of the start codon in CDC Landmark (CS RefSeq v1.1, 6A:145, 654, 767 - 145, 654, 768). ' See the MASWheat webpage for amplification conditions and note that those conditions should be considered only as a starting point of the method optimization at individual laboratories.
Type	KASP
PCR primers	plz-pro-ins-FAM 5'- GAAGGTGACCAAGTTCATGCTccatgcacgcgaaagatcaa -3' plz-pro-wt-VIC 5'- GAAGGTCGGAGTCAACGGATTgaaaacaaaagagagatcaaacc -3' plz-pro-common 5'- GCAATTCTCCTCTTGGTTGGT -3'