Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: CDM158_KASP

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	CDM158_KASP
Reference	Dubcovsky J MAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stripe rust resistance gene Yr78 MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks	Capital letters indicate the VIC and FAM tails. The primers labelled with VIC are Yr78 specific and discriminate the H1 haplotype
Type	KASP
PCR primers	FAM GAAGGTGACCAAGTTCATGCTtgcaaaatagaacgcttggc VIC GAAGGTCGGAGTCAACGGATTtgcaaaatagaacgcttgga common tgctatgcctttgtaaattccttt