Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: IWA7257_KASP

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	IWA7257_KASP
Locus	Yr78 IWA7257
Reference	Dubcovsky J MAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stripe rust resistance gene Yr78 MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks	The capital letters indicate the VIC and FAM tails, IWA7257_Rev_A_VIC is the primer specific for QYr.ucw-6B
Type	KASP
PCR primers	IWA7257_Rev_A_VIC GAAGGTCGGAGTCAACGGATTagaccctacgacgttagcga IWA7257_Rev_C_FAM GAAGGTGACCAAGTTCATCTagaccctacgacgttagcgc IWA7257_Com1 (common) attggaatcagctgggtcat