Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: Stars-KASP824

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	Stars-KASP824
Locus	Stars-KASP824
Reference	Xu X et al. (2024) Characterization of quantitative trait loci for leaf rust resistance in the Uzbekistani wheat landrace Teremai Bugdai Phytopathology.
General Remarks	SNP alleles from Teremai Bugdai / TAM110: C/G
Type	KASP
PCR primers	Allele-specific primer AAGAGGCAAGCCCAAAGTTG Allele-specific primer GATCTGGTCCTCATCACCCG Common primer AAGAGGCAAGCCCAAAGTTC