Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: fcp718_SSR

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	fcp718_SSR
Locus	fcp718
Reference	Sharma JS et al. (2019) Mapping and characterization of two stem rust resistance genes derived from cultivated emmer wheat accession PI 193883. Theoretical and Applied Genetics 132:3177-3189.
General Remarks	~Product size (bp) = 170, 250, 275 Inheritance/phase = Dominant/coupling
Type	SSR
PCR primers	F CCCATCAGATTAACAGCTCTA R ATGAGCAGGATAAAGACACTG