Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: Ax95083494_KASP

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	Ax95083494_KASP
Reference	Zhao R et al. (2023) Mapping and characterization of a novel adult-plant leaf rust resistance gene LrYang16G216 via bulked segregant analysis and conventional linkage method Theoretical and Applied Genetics 136.
Type	KASP
PCR primers	Forward A_FAM: GAAGGTGACCAAGTTCATGCTtggtgacgggagacaggaG Forward B_VIC: GAAGGTCGGAGTCAACGGATTtggtgacgggagacaggaA Common reverse: agtgctacgtacgcatgtcg