Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: WRC1448_KASP

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	WRC1448_KASP
Locus	WRC1448
Reference	Grewal S et al. (2022) Chromosome-specific KASP markers for detecting Amblyopyrum muticum segments in wheat introgression lines. The Plant Genome 15.
General Remarks	Validated chromosome-specific KASP assay diagnostic for Am. muticum in wheat
Type	KASP
PCR primers	Allele-specific primer A 5' tgcaagatcatcaatgatggctA Allele-specific primer B 5' tgcaagatcatcaatgatggctG Common primer 5' aagaggctgaagctatgcgc