Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: KASP-Gb5-3

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	KASP-Gb5-3
Reference	Xu X et al. (2021) Development of KASP markers for wheat greenbug resistance gene Gb5 Crop Science 61:490-499.
General Remarks	Alleles = C/G
Type	KASP PCR
PCR primers	Allele specific primer 1 CTCCACCACGACGAGCTTTGTC Allele specific primer 2 CTCCACCACGACGAGCTTTGTG Common primer TCGCCGTCCGAGTATGCCTTAC
Source Gene	Gb5 (Triticum)