Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: KASP_PH3L

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	KASP_PH3L
Locus	RAC875_rep_c94907_221
Reference	Liu G et al. (2023) Identification of KASP markers and putative genes for pre-harvest sprouting resistance in common wheat (Triticum aestivum L.) 11:549-557.
General Remarks	SNP = C/T
PCR primers	SNP primer allele 1 5' CCATGGCAGCATCCCGGT SNP primer allele 2 5' CCATGGCAGCATCCCGGC Common primer 5' TGACGTTGAAGAACTGCAGA