Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: TaSnRK2.9-1A qRT-PCR-F/R

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	TaSnRK2.9-1A qRT-PCR-F/R
Reference	Ur Rehman S et al. (2018) A wheat protein kinase gene TaSnRK2.9-5A associated with yield contributing traits Theoretical and Applied Genetics 132:907-919.
General Remarks	Gene expression level detection in transgenic rice
Type	PCR
PCR primers	F: CGACGAGGCTCGCTTCTTTT R: CCCACAGTTGACTTTGGTTGA