Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: KASP974

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	KASP974
Reference	Niu F et al. (2020) The Hessian fly recessive resistance gene h4 mapped to chromosome 1A of the wheat cultivar 'Java' using genotyping-by-sequencing Theoretical and Applied Genetics 133:2927-2935.
General Remarks	Physical position on Chinese Spring (IWGSC v1.0) : 9, 011, 078
Type	KASP
PCR primers	Forward primer1 5' GTCCAGCACGACGGACAGGA Forward primer2 5' GTCCAGCACGACGGACAGGG Reverse primer 5' CGCACCATCAACCAGCTC