Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: Yr15-R8

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	Yr15-R8
Reference	Rasheed A et al. (2016) Development and validation of KASP assays for genes underpinning key economic traits in bread wheat. Theoretical and Applied Genetics 129:1843-60.
General Remarks	FAM = Yr15+ HEX = Yr15-
Type	KASP
PCR primers	FAM 5' cagatccccggttctctcaaG HEX 5' cagatccccggttctctcaaA Common Reverse cccccaaatgatcgagaata
Source Gene	Yr15-2 (Triticum)