Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: IWA7777_KASP

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	IWA7777_KASP
Locus	wsnp_Ra_c24707_34262900 IWA7777
Reference	Pandurangan S et al. (2021) Validation of a SNP-KASP marker for the Fusarium head blight resistance quantitative trait loci on chromosome 5AS Canadian Journal of Plant Science 101:135-139.
PCR primers	IWA7777-Fam GAAGGTGACCAAGTTCATGCTtcagcatacatttgtgcaactttA IWA7777-Hex GAAGGTCGGAGTCAACGGATTtcagcatacatttgtgcaactttG IWA7777-KaspR attaacttcttcaaagacaccgtc