Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: sts32

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	sts32
Reference	Schweiger W et al. (2016) Suppressed recombination and unique candidate genes in the divergent haplotype encoding Fhb1, a major Fusarium head blight resistance locus in wheat Theoretical and Applied Genetics 129:1607-1623. Liu S et al. Toward positional cloning of Fhb1 , a major QTL for Fusarium head blight resistance in wheat Cereal Research Communications 36:195-201.
General Remarks	(Curator Note, VCB 2023) The probe STS32 also exists and was mapped on 3B. These may be the same. Primers used to screen a BAC library for Fhb1. See reference for links to additional markers. common PCR protocol: 15'' denaturing 94deg. C/15'' annealing/15'' elongation, 45 cycles, 375 nM primer, 40ng/ul DNA, ssoAdvanced polymerase, 5ul reaction volume
Type	PCR
PCR primers	GGACGAGTCCTCAGCCCTAT CGGTGAAGATGAGCTTCCAT