Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: KASPYr27

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	KASPYr27
Locus	Yr27
Reference	Athiyannan N et al. (2022) Long-read genome sequencing of bread wheat facilitates disease resistance gene cloning Nature Genetics 54:227-231.
General Remarks	PCR cycling was performed in an ABI QuantStudio 6 Flex Real-Time PCR machine as follows: preread at 30 deg. C for 60s; hold stage at 94 deg. C for 15min; and then ten touchdown cycles (94 deg. C for 20s; touchdown at 61 deg. C, decreasing by 0.6 deg. C per cycle for 60s), followed by 29 additional cycles (94 deg. C for 20s; 55 deg. C for 60s). The plates were then read at 30 deg. C for endpoint fluorescent measurement.
Type	KASP
PCR primers	[Fam]Forward1:[GAAGGTGACCAAGTTCATGCT]AACCTTCCATCCCTGGAGA [Hex]Forward2:[GAAGGTCGGAGTCAACGGATT]ACCTTCCATCCCTGGAGG CR:ATGCAAGGCGGTAGCAAT
Sequence	KASPYr27
Source Species	Triticum aestivum
Source Germplasm	Kariega