Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: KASPYr28

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	KASPYr28
Locus	Yr28
Reference	Athiyannan N et al. (2022) Haplotype variants of the stripe rust resistance gene Yr28 in Aegilops tauschii Theoretical and Applied Genetics.
General Remarks	An 8ul KASP reaction with ~ 25 ng of genomic DNA, 0.11ul of assay mix and 4ul of the KASP master mix. PCR was carried out in BioRad CFX96 real-time PCR system as follows: initial denaturation at 94 deg. C for 15 minutes, denaturation at 94 deg. C for 20 seconds, and annealing at 65 deg. C for 1 minute. The program was repeated nine times with a decrease in annealing temperature of 0.8 deg. C per cycle followed by denaturation at 94 deg. C for 20 seconds, annealing at 57 deg. C for 1 minute for an additional 35 cycles. The PCR products were read at 30 deg. C for an endpoint fluorescence measurement using the inbuilt reader.
Type	KASP
PCR primers	[Fam]Forward1:[GAAGGTGACCAAGTTCATGCT]TATGCTAGAAGATATTGGG [Hex]Forward2:[GAAGGTCGGAGTCAACGGATT]TATGCTAGAAGATATTGGC CR:TGACATTTGAGATACTGACCAC
Sequence	KASPYr28
Source Species	Aegilops tauschii
Source Germplasm	Aegilops tauschii CPI110672