Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: BE489611-2D

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	BE489611-2D
Data at Wheat_SNP	BE489611-2D
Reference	Akhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks	SNP T>G;G>A;A>C;T>C;G>A;C>T;C>T;C>T;C>G;T>C;G>A at 87;115;189;221;226;243;255;297;300;303;306 [ Show all 7 ]
Type	EST SNP
PCR primers	BE489611A_R1 tgacagctacagtgtgcaatacatttgc BE489611_cpF1 cgggcctcctagcgcagaag
Sequence	BE489611
Linkage Group	2D
Source Species	Triticum aestivum