Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: AF291748

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	AF291748
Similar Probes	{SpCl-531}
Reference	Kantety RV et al. (2002) Data mining for simple sequence repeats in expressed sequence tags from barley, maize, rice, sorghum and wheat Plant Molecular Biology 48:501-510.
General Remarks	Motif gtcgtcgtcggcgtcgtcgt, length 20 bp Motif GTCGTCGTCGGCGTCGTCGT, length 20 bp
Type	SSR EST
Sequence	AF291748
Source Species	Zea mays