Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: HORVU.MOREX.r3.5HG0501560

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	HORVU.MOREX.r3.5HG0501560
Locus	HORVU.MOREX.r3.5HG0501560.1
URL	Gene Ontology GO:0016740 Gene Ontology GO:0016747
Reference	Brauer E et al. (2025) Transcriptional Profiling and Genetic Mapping of Barley Responses to Bacterial Flagellin Molecular Plant Microbe Interactions. Mascher M et al. (2021) Long-read sequence assembly: a technical evaluation in barley The Plant Cell.
General Remarks	confidence=high biotype=protein_coding description=Agmatine coumaroyltransferase-2 GO:0016740 transferase activity GO:0016747 transferase activity, transferring acyl groups other than amino-acyl groups
Type	SNP
PCR primers	Forward 5' ACTACCGGCCTTCGTCCAG Reverse 5' TGAAGTGCGCCTTGTGTATG
Source Gene	ACT (agmantine coumaroyltransferase) (Hordeum)
Source Species	Hordeum vulgare