Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: BA00492199_KASP

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	BA00492199_KASP
Locus	AX-95171280
Related Probe	BA00492199
General Remarks	SNP = A51G [ Show all 8 ]
Type	KASP
PCR primers	KASP primer A 5' cgtggagatggtcaaagccA KASP primer B 5' cgtggagatggtcaaagccG KASP Common Primer 5' ttacacccgtccctaagcgt
Source Species	Triticum aestivum