Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: ABG702

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	ABG702  [ Marker Report ]
Locus	ABG702 ABG702B ABG702a ABG702(A) ABG702(B)
Synonym	Synonym HAR35_25320 HAR35_30748 HAR35_6023
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	TCATGTACGTCGGCCATCTC CCGAGAAAACATCAAACCTG
Sequence	L44085 ABG702
Source Species	Hordeum vulgare